Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG813
Clone ID XG813
Vector pGT1Lxf
Project baygenomics

Sequence tag XG813
Sequence
GCTTCCCAAGACAGCCCTGCATCTTCAGTGACAAGATGGTCTCTGTACAGATCACCCTGACTAATACTTCTGATCGAAAA
ATAGAAAACATCCACATAGGTGGGAAAGGGCTTCCTGTGGGCATGCAGATGCATGCCTTTCATCCAATAGACTCTCTGGA
GCGTAAGGGGTCCGTGACTGTCTCATGTGGGTATTGACTTTTGTGATTCTACACAGACGGCCAGTTTCCAATTGTGCACC
AAGGATGAGTGCTTCCACGTCACCCTCCAAGCCTACCTGTTGGGGAGCTGCATTTCACCTGTGGCCATGTCAGACAAGGA
TCTTTAAAAAGGAGCA
Sequence Type mRNA
Unitrap ID UNI9691

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 95298202..95312829 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021686 (Ap3b1) NM_009680 adaptor-related protein complex 3, beta 1 subunit Gene [Source:MGI Symbol;Acc:MGI:1333879]

 
Come back to gene ENSMUSG00000021686


For any suggestions or comments, please send an email to unitrap@crg.es