Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC010
Clone ID RRC010
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC010
Sequence
TTTCCATCGCCTGCAATTGGAAGACCTATTATGCAAGGAATGATACTGTGCGTTTTGCTTTGGATGTCCTTGCTATTCTC
ACTGTGGTGCCAAAAATCCAGCTCCAGTTGGCGGAGTCAGTGGATGTACTGGACGAGGCCGGCTCTGCTGTCTCCGACTG
T
Sequence Type mRNA
Unitrap ID UNI9692

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106754402..106756623 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040325 (Vprbp) NM_001015507 Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

 
Come back to gene ENSMUSG00000040325


For any suggestions or comments, please send an email to unitrap@crg.es