Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14996
Clone ID OST14996
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14996
Sequence
GACCTGTGAATACTGACGATATTGATCTAGCTGGTGACATCATCCAGTCGATCGCGTCCTTTTTTGCTATTGAAGACCTT
CAGGTAGAAGCAGATTTCCCTGTGTACTTCGAGGAACTACGGAAAGTGCTGGTGAAGGTGGATGAGTATCATTCAGTGCA
TCAAAAGCTCAGCGCCGACATGGCTGATAATTCTAACCTCATCCGAAGTTTGCTGGTCAGAGCGGAGGATGCTCGGCTGA
TGAGGGACATGAAAACAATGAAGAGTCGTTACATGGAGCTCTATGACCTTAATAAAGATTTGCTGAATGGATACAAGATT
CGCTGTAACAACCACACAGAACTGCTAGGAAACCTGAAGGCGGTGAACCAAGCAATCCAAAGAGCAGGCCGTCTGCGCGT
TGGAAAGCCAAAGAACCAGGTGATCAGTGCTTGTCGGGATGCGATTCGAAGCAACAACATCAACACCCTCTTCAGAATCA
TGCGAGTGGGCACTGCTCCTTCATAGGAGACAGGGAAAGAGGAAGGAAGCCCCTGCAAAAGGNCTAGACACGGAGCCTGG
CTGGCTCCCGATCACAGCCTGGGCATTCAGCTGCTAAGGATGAAACCATGCTAACTGATAC
Sequence Type mRNA
Unitrap ID UNI28956

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 96592061..96599156 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031755 (Bbs2) NM_026116 Bardet-Biedl syndrome 2 (human) Gene [Source:MGI Symbol;Acc:MGI:2135267]

 
Come back to gene ENSMUSG00000031755


For any suggestions or comments, please send an email to unitrap@crg.es