Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14910
Clone ID OST14910
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14910
Sequence
TTAAGGTACTTGCTAGGGCGGATCCTCACCGGAAGTTCGGAGCCAGAGGCTGCTCCTGCCCCGCGCCGCCTCCGCCGATC
TGTGGACCAGGATTTGGGTCCCGAGGTGCCCCCTGAGAACGTACTGGGGGCTCTGCTACGCGTCAAACGCCTGGAGAACC
CCTCGCCCCAGGCGCCGGCACGCCGCCTCCTGCCTCCCTGAGCGCTGCTGCATCCTGCACGCCCTGGAACCCAGGAGCGC
CCCAGCAACCCTGACTCCCTGCCAGCACGTCCAAGGCTGCTTACCCCANCAACCTCCCATCCCCTGAGCCCTCAATAAAT
GCCATCTGTAGCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28961

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7500032..7500361 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039278 (Pcsk1n) NM_013892 proprotein convertase subtilisin/kexin type 1 inhibitor Gene [Source:MGI (curated);Acc:Pcsk1n-001]

 
Come back to gene ENSMUSG00000039278


For any suggestions or comments, please send an email to unitrap@crg.es