Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG047
Clone ID XG047
Vector pGT1Lxf
Project baygenomics

Sequence tag XG047
Sequence
TCCGGCAGCCAGGCAGCATGGCGGCGGTGGAGACGCGGGTGTGCGAGACGGACGGCTGCAGCAGCGAGGCCAAGCTCCAG
TGTCCCACCTGCATCAAGCTGGGCATCCAGGGCTCGTACTTCTGCTCGCAGGAATGCTTTAAAGGAAGCTGGGCCACTCA
CAAGTTACTACATAAGAAAGCAA
Sequence Type mRNA
Unitrap ID UNI9697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 138146031..138152352 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005813 (Metap1) NM_175224 methionyl aminopeptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1922874]

 
Come back to gene ENSMUSG00000005813


For any suggestions or comments, please send an email to unitrap@crg.es