Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14784
Clone ID OST14784
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14784
Sequence
AAAGATGAAGGCAGAGATCAGGAGGGAAAAGANCTTTGGAGGGGAACTGCGCATCTCCTTCCAGGAGCCCGGAGGGGAGA
GACAGCTGCTCAGCAGCAGGAAGACCCTAGCAGATTATGGGATATTCTCTAAGGTGAACATTCAAGTGCTGGAGACCTTT
CCTCCTGAGATCCTGGTCTTTGTGAAGTATCCTGGTGGCCAGAGCAAGCCTTTCACCATCGACCCTGATGATACCATCTT
AGATCTGAAAGAGAAGATAGAAGATGCTGGAGGCCCTTGTGCGGAGGATCAGGTACTACTGTTGGATGATGAGGAGTTGG
AAGANGATGANAGCCTTAAAGAGCTTG
Sequence Type mRNA
Unitrap ID UNI14098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115360983..115361329 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029561 (Oasl2) NM_011854 2'-5' oligoadenylate synthetase-like 2 Gene [Source:MGI (curated);Acc:Oasl2-001]

 
Come back to gene ENSMUSG00000029561


For any suggestions or comments, please send an email to unitrap@crg.es