Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG049
Clone ID XG049
Vector pGT1Lxf
Project baygenomics

Sequence tag XG049
Sequence
GCAGTCCAAGCCATTCAGAATATAACTCAGGCACTCCAGAAGTCGAAGGAAAATTACACTGCCAAATGTGTAGAACAGGA
ACGTCTGAAAAAGGAAGGAGCTACACAAAGAGAAATAGAAAAGGCAGCTGTTAAGTCTAAGAAAGCTACAGATACTTATA
AACTTTATGTGGAAAAGTATGCATTAACAAAAGCAGATTTTGAGCAGAAGATGACAGAAACAGCCCAGAAATTTCAAGAT
ATTGAAGAAACTCACCTCATTCACATAAAGGAAATTATCGGATCCTTGTCAAATGCTGTCAAGGAGATCCACTTACAGAT
CGGCCAGGTTCATGAAGAGTTTATAAATAACATGGCTAATACTACAATTGAAAGTTTGATTCAGAAATTTGCCGAGTCAA
AAGGCACAGGGAAGGAAAGACCT
Sequence Type mRNA
Unitrap ID UNI9698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99545777..99559440 124
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041685 (Fcho2) NP_766179 FCH domain only 2 Gene [Source:MGI Symbol;Acc:MGI:3505790]

 
Come back to gene ENSMUSG00000041685


For any suggestions or comments, please send an email to unitrap@crg.es