Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0702
Clone ID AX0702
Vector pGT0lxr
Project sanger

Sequence tag AX0702
Sequence
CGAAACATGCCTGAAAAGTTGGAGGATTAGGGGATATGGAACGAGAGGGGGCGGATGGAGGGGGCGGCGGCGGCGACCTG
GGCGAGCGCAGGAGCGAGGCCGGCCTCGGGGCCGCGGTGGATGGTTTCTAAGATGATCATCGAAAACTTCGAGGCGCTCA
AGTCCTGGCTCAGCAAGACCCTCGAGCCCATCTGTGATGCAGATCCATCAGCCCTAGCAAAATATGTTTTGGCTCTGGTA
AAGAAAGACAAAAGTGAAAAAGAATTAAAGGCGTTATGCATTGATCAGCTTGATGTATTTCTTCAGAAAGGTCCA
Sequence Type mRNA
Unitrap ID UNI1066

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 105559710..105576138 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022119 (Rbm26) NM_134077 RNA binding motif protein 26 Gene [Source:MGI Symbol;Acc:MGI:1921463]

 
Come back to gene ENSMUSG00000022119


For any suggestions or comments, please send an email to unitrap@crg.es