Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14489
Clone ID OST14489
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14489
Sequence
GGATGTGTTTGAAATGCGCTTTGCCAAGATGCCTGATGAGCCTGAAGAGCCAGTTGTTACAGTGTCCTCTCCTGCAGTGC
CACCCCCTACAAAGGTGGTAGCCCCACCCTCATCTAGTGACAGCAGCAGCGACAGTTCTTCCGACAGCGACAGTTCCACT
GACGACTCTGAGGAAGAGCGAGCCCAGCGGCTGGCTGAACTCCAGGAACAGCTCAAGGCCGTGCATGAGCAGCTTGCAGC
CCTCTCACAGCCCCAGCAGAACAAACCAAAGAAAAAGGAGAAGGACAAGAAGGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI4057

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32350581..32351786 211
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es