Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14486
Clone ID OST14486
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14486
Sequence
CTCTGGGCTGTGTCATGGCCGAGCTACATCTGGGCTGGCCTCTCTACCCAGGCAACAATGAGTATGACCAGGTGCGCTAC
ATCTGTGAGACCCAGGGCTTACCCAAGCCCCATTTGCTGCATGCGGCTCGCAAGGCTCACCACTTNTTCAAGCGTAACCC
CCACCCCGATGCCACCAACCCNTGGCANCTGAAGNCCTCTGNTGACTACCTAGCTGAGACCAAGG
Sequence Type mRNA
Unitrap ID UNI28976

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28313448..28313672 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040424 (Hipk4) NM_001033315 homeodomain interacting protein kinase 4 Gene [Source:MGI (curated);Acc:Hipk4-001]

 
Come back to gene ENSMUSG00000040424


For any suggestions or comments, please send an email to unitrap@crg.es