Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14450
Clone ID OST14450
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14450
Sequence
CTACAAAAGGGATGGGACGCAANAGCANNGCTTCCAGACAGCACCCTGCGGTCTCCATCATTCCCCATCCATGAGGAGGA
CGAGGAGAAGCTCTCAGAGGACTCGGATGCTCCTCTCCCACCGAGCGGTGTGGAGCTGGTACTGCGGGAGAGCAGCTCCC
CTGAGAGTTTCGGAACAGANGAGGGAGATGAGCCGCCCT
Sequence Type mRNA
Unitrap ID UNI28977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4930688..4931145 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022517 (Mgrn1) NP_083933 mahogunin, ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2447670]

 
Come back to gene ENSMUSG00000022517


For any suggestions or comments, please send an email to unitrap@crg.es