Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14410
Clone ID OST14410
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14410
Sequence
GGAAATACCAGAGGGGCACCAGGGTCCGGCTGCGTCTCCTGGATCTTGAGCTGACATCTAGGTTCCTGGGTGGGACCACA
GATACAACTATACTGGAGGCTGATGCAGTTCTCTTAGGACTCCAAGAGATCAGGGACTCAAAATCAAGAGAGGAGCAACC
CAGCAAGTAATGGACTGCGCTTGCTGTATTTGAACCCATTTTGAGCCC
Sequence Type mRNA
Unitrap ID UNI12869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8802208..8802415 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040269 (Mrps28) NM_025434 mitochondrial ribosomal protein S28 Gene [Source:MGI (curated);Acc:Mrps28-001]

 
Come back to gene ENSMUSG00000040269


For any suggestions or comments, please send an email to unitrap@crg.es