Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14246
Clone ID OST14246
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14246
Sequence
GGAAGGTGAATCTTCTGGAAAGAGGAAAGCGGAAGACGATGACAAAGCGAATAAAAAGCATAAGAAGTATGTGATCAGTG
ATGAAGAAGAAGAAGAAGATGACTGAGCTACAAACTGTGAATGCGTTTTATATATTTATTGTACAGCTTGTCTATAAATA
CAATGTAAACATGAGTTATTTTGATTGAGATTAATTGATCTGTTTGTGAAATTTTGATTGTAATAAAACATTTAAGGCAA
AAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI2579

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75314000..75314239 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042487 (Leo1) NM_001039522 Leo1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2685031]

 
Come back to gene ENSMUSG00000042487


For any suggestions or comments, please send an email to unitrap@crg.es