Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST14162
Clone ID OST14162
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST14162
Sequence
GGCTTTGGAGACTCGAGCCAGCCCTGGCCCACTCCAGGCTGTGTCACCTTTGTCCTGAACGACCAGAGCATGGCCTTCAC
TGGAGATGCCCTGCTGATCCGAGGGTGTGGACGGACAGACTTCCAACAAGGCTGTGCTAAGACTTTGTACCACTCTGTGC
ACGAGAAGATCTTCACACTTCCAGGCAACTGTCTAATCTACCCGGCTCACGATTACCACGGGCTCACAGTTTCTACTGTG
GAGGAGGAACGGACTCTGAACCCACGGCTTACCCTCAGCTGTGAGGAATTTATCAAGGTCATGGACAACCTGAACTTGCC
CAAGCCACAGCAGATAGACATTGCTGTTCCTGCAAATATGCGCTGTGGGGTCCAGACTCCACCCTCCTGATTCGTCCAGC
CAGCTGGTACATCCGTTATGAATGCCTAGGAGGGGTGAGGGGAAGGG
Sequence Type mRNA
Unitrap ID UNI28981

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25391223..25393854 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064254 (Ethe1) NM_023154 ethylmalonic encephalopathy 1 Gene [Source:MGI (curated);Acc:Ethe1-001]

 
Come back to gene ENSMUSG00000064254


For any suggestions or comments, please send an email to unitrap@crg.es