Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG271
Clone ID XG271
Vector pGT1Lxf
Project baygenomics

Sequence tag XG271
Sequence
GCCGAGGGCTTCCGGGAGCAGCTGACACAGTGTGCTGGACTGCTAGAGCAACTGGAGAGGCTGTTTCTCCATGGAAAATC
AGCCAGAGTGGAACCACATCCCCAGAAT
Sequence Type mRNA
Unitrap ID UNI9718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 69918383..69925597 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039298 (Cdk5rap2) NM_145990 CDK5 regulatory subunit associated protein 2 Gene [Source:MGI (curated);Acc:Cdk5rap2-001]

 
Come back to gene ENSMUSG00000039298


For any suggestions or comments, please send an email to unitrap@crg.es