Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST13885
Clone ID OST13885
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST13885
Sequence
GGCTTTAGGCAATGGCGACCCTTCTNCCGGATCTACAGACACCCACGAAGAGGAGGACTCCCCACCATTGCCTCTGGGAC
CCCCAATCCCTGGTGATCCCTGGCCTGGGGCGCCTCCTTTGTTTGATGAACCTCCGCCTCCAGGCTCCAACCGTCCCTGG
AGAGATCTTCCTGACAGTGGTGCCTGGCCCCCAAAGCCCCCAAGCACTGATCCCCCTAAACCTCCTCTGCCTGATGACCC
CTGGCCAGCAGGAACCCAGCCCCCAGAAAACCCCTGGCCTCCTGCCCCTGAGATGGACCATGAATCTCAGGAGGAGCCAG
ACCTTGACCCACCCCAGGAAGAGTATAGATAGGGGACCCTAAGGAACGTGAGCCTNCACAGAGCACACCAAAGCCCACCT
TTTTCATTGGCTGCCG
Sequence Type mRNA
Unitrap ID UNI28708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35670848..35671259 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024409 (Psors1c2) psoriasis susceptibility 1 candidate 2 (human) Gene [Source:MGI Symbol;Acc:MGI:1930025]

 
Come back to gene ENSMUSG00000024409


For any suggestions or comments, please send an email to unitrap@crg.es