Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST13825
Clone ID OST13825
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST13825
Sequence
GGTCCAGAAGGATGCAGATGCTGTGGACAAGGTAATGAAGGAACTGGATGAAAACGGAGATGGGGAAGTGGACTTCAAGG
AGTATGTTGTGCTGGTGGCTGCTCTCACAGTGGCTTGTAACAACTTCTTCTGGGAGACCAGTTGAGCACAGTCTGTGAGC
AGTGCCCTTCCTCTCCCACTTGTCAAGATTTCCCCTTTAGCGTGCTTGCTCCTCACCCCACCTGTACCTCCCTATGTCCC
CATCCTTGCCCAGTCTCGACGTGCACCAAGGGCACAAGAGTGGCAGTCCAGATCTGCCACTTGTTTTAATAAAGCCTTCT
CTCTCACCAGC
Sequence Type mRNA
Unitrap ID UNI28547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90314957..90315287 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044080 (S100a1) NM_011309 S100 calcium binding protein A1 Gene [Source:MGI (curated);Acc:S100a1-001]

 
Come back to gene ENSMUSG00000044080


For any suggestions or comments, please send an email to unitrap@crg.es