Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG040
Clone ID XG040
Vector pGT1Lxf
Project baygenomics

Sequence tag XG040
Sequence
AATTCATTTTGACAGTCCATTTGAGTTTGGCTTCACATTCCGGAACCCAGATGATGTCTTCAGGGAATTTTTTGGTGGAA
GGGACCCATTTTCATTTGACTTCTTTGAAGACCCATTTGATGACTTTTTTGGAAACCGAAGGGGTCCCCGAGGAAATAGA
AGCCGAGGTGCCGGCTCATTTTTCTCTACCTTCAGTGGATTTCCTTCTTTTGGAAGTGGATTTCCTGCTTTTGATACAGG
CTTCACTCCATTTGGGTCACTAGGTCATGGGGGTCTCACTTCATTTTCTTCAACGTCATTTGGCGGCAGTGGAATGGGCA
ACTTCAAATCAATATCAACTTCAACTAAGATAGTTAATGGCAAAAAAATCACGACAAAGAGGATTGTGGAGAACGGTCAA
GAAAGAGTAGAAGTTGAAGAAGATGGGCAGTTAAAGTCCTTGACAATAAAT
Sequence Type mRNA
Unitrap ID UNI141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30080086..30092934 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es