Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST13752
Clone ID OST13752
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST13752
Sequence
AGGGCCCGGGCTTGTACATGGAAAGGAGATGGCAAAGGGGTACCGGCGGCCACTGGCCCACGCCAAACCACCATATTCCT
ACATCTCTCTCATAACCATGGCTATTCAGCAGGCTCCAGGCAAGATGCTGACCCTGAGTGAAATCTACCAATGGATCATG
GACCTCTTCCCGTACTACCGGGAGAACCAGCAACGTTGGCAGAACTCCATCCGGCATTCGCTGCCTTCAATGACTGNTTC
GTCAAGGTGGCACGCTCCCCA
Sequence Type mRNA
Unitrap ID UNI28992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19599997..19600258 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040891 (Foxa3) NM_008260 forkhead box A3 Gene [Source:MGI (curated);Acc:Foxa3-001]

 
Come back to gene ENSMUSG00000040891


For any suggestions or comments, please send an email to unitrap@crg.es