Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG064
Clone ID XG064
Vector pGT1Lxf
Project baygenomics

Sequence tag XG064
Sequence
GTGAAATAGCGACCAAGTCACCTCTGCTTACCTTTCCCAGCAAAGAGCCTTTGCGATCAGTCCTCCAGTACAATTCAGCT
ATGAAAAACGATACGGTCACCCCTGCTGAACTGAGTGAGCTCCGAAGTACCATCATCAACTTGCTAGATCCTCCTCCTGA
GGTGTCTGCCCTCATCAACAAGCTGGACTTTGCCATGTCTACCTATCTCTTGTCTGTGTATCGGCTGGAGTACATGAGGG
TACTGCGTTCTACAGATCCAGATCGCTTCCAGGTAATGTTCTGCCACTTTGAGGATAAAGCTATTCAAAAATACCAAT
Sequence Type mRNA
Unitrap ID UNI9723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17323084..17325590 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041720 (Pi4ka) NM_001001983 phosphatidylinositol 4-kinase, catalytic, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:2448506]

 
Come back to gene ENSMUSG00000041720


For any suggestions or comments, please send an email to unitrap@crg.es