Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST13706
Clone ID OST13706
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST13706
Sequence
CGATCCTAGCCCGGGATGGNCCTAACGCCCTCACACCACACGCCCACCACCCCANAATGGGTCAAGTTCTGCCGGCAGCT
GTTTGGNGGCTTCTCTATNCTGCTGTGGATCGGGGCAATCCTTTGCTTCCTGGCCTATGGCATCCAGGCAGGGACGGAGG
ATGACCCTTCCGGTGACAATGTGAGTGTGCCCCACCACCCTGGCCTGTCTGTGTAAAACCCCACACATTGAAGAACACAC
CCACAGTCCGCCTAGACTCCCCACCTT
Sequence Type mRNA
Unitrap ID UNI28994

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25785510..25785773 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040907 (Atp1a3) NM_144921 ATPase, Na+/K+ transporting, alpha 3 polypeptide Gene [Source:MGI (curated);Acc:Atp1a3-002]

 
Come back to gene ENSMUSG00000040907


For any suggestions or comments, please send an email to unitrap@crg.es