Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST13661
Clone ID OST13661
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST13661
Sequence
GGAACGACTAAGGCGGTTAAACCACAGCGTGGCCAAGGAAACAGCTCGCAGGAGAGCTATGCTGGATTCAGGAGTTTACC
CTCCTGGTTCTCCAAGCAAATAAGCACGGGCCCGTGACCTGAGTATACAAGTACAATTCTCCAACGGCTTTGTCTGGTAG
ACACGAGAAGATTCCAGGAAAGTCTCTGTAGACCTTTGATTTTTTTTGCACTATGTACTCATTCATGTAGCCGCCTCAAG
AAACATGCGTACGGCAGGACTATTTCCTAAAGAACCTCCATCACAGCTTGTCCATCCAAGAAAGAGCCTCTACCTTTTGG
GTTTTGTTAATCTTGAGACAAGATCTCAGTATGTAGTCCCGGCTGGCCTCAAACATGTCCTCTTGCCTTAGCCTCCTGAA
TGCTGGGATTATAATAGGCATGTGTCA
Sequence Type mRNA
Unitrap ID UNI28688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90293090..90293516 427
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001018 (Snapin) NM_133854 SNAP-associated protein Gene [Source:MGI (curated);Acc:Snapin-001]

 
Come back to gene ENSMUSG00000001018


For any suggestions or comments, please send an email to unitrap@crg.es