Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG096
Clone ID XG096
Vector pGT1Lxf
Project baygenomics

Sequence tag XG096
Sequence
GTCCCCGGGCGGCGGCAGCTCCAAGATGGCGCAGGCGATCTTCGAGGCCCTGGAG
Sequence Type mRNA
Unitrap ID UNI9727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154439084..154439137 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059842 (Zfp341) NM_199304 zinc finger protein 341 Gene [Source:MGI (curated);Acc:Zfp341-001]

 
Come back to gene ENSMUSG00000059842


For any suggestions or comments, please send an email to unitrap@crg.es