Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST13483
Clone ID OST13483
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST13483
Sequence
ACACCGAGTACCCTACCCCTCGTGGACACCATCGCTGTCTCCGGCTGCTTGAAGCTGTCCTTTATCACCTTCCAGACTCA
GAACTTTCGTCCTGCCCACCAGGCACCCATGGCTCANACTACCATCCATATGGNTCACAGCACCCCTGGACAGATGNTCT
CTACTCCTGGAATCCCTCCTGTGGTGTACCCCACCCCAGCCTATACCATACCTTTCTACACCCCCATTCCAAATGGGCTT
TACCCGTNCAAGTCCATCATGATATNAGGCAATGTCTTGCCAGATGCTACNAGGTTCCATATNAACCTTTGNTGTGGAGG
TGNCATTGGTTTCCACCTGGAACCCCCGGTTTCAAA
Sequence Type mRNA
Unitrap ID UNI16143

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78779297..78784894 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]

 
Come back to gene ENSMUSG00000001123


For any suggestions or comments, please send an email to unitrap@crg.es