Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST13223
Clone ID OST13223
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST13223
Sequence
AGAGGGATTTGGCTCTTGCTCTGAGGGGAGCCTCACAGATTNCAGACGGNCGTGGCAAGTCCAAGCATCGCGTCTCTACC
ATGTCCCAGAGCCAGAAGAGAGGCTGTTGTTTGGAAAGGCAAGAAGAATTCCCCAAACTTGGCCAGAATTGTATTGTAGA
CAAGATGGAGGAGGAACAGTTTACAGGAAGGCCTCCAACGCGCCCGCACACAGATGCACTTCCTGTGAAAGCACTGGTGC
AGATGCTCTGAGTGTAAGCAGCCAGTGTCTTGGAGGCATCAGCAACCCTCCTTCATGACCTTATTAATAAAGTCCAAGAT
TCCCTTCGCAATTAAGAAGGGAGCATCAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI14108

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116529355..116529703 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075410 (OTTMUSG00000003947) predicted gene, OTTMUSG00000003947 Gene [Source:MGI Symbol;Acc:MGI:3649529]

 
Come back to gene ENSMUSG00000075410


For any suggestions or comments, please send an email to unitrap@crg.es