Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG241
Clone ID XG241
Vector pGT1Lxf
Project baygenomics

Sequence tag XG241
Sequence
GGCAGACACAGAGCCAGATGTGACAGTTTGTCCCATTCTCTCAGCAGCACTAGCAGCAGCAGCAGCAGCAACTGGTAAAA
GGGGCCGTGTACGGAAGTGGGGCACTTCCACCAAGACCACAGAGGAGGACAGGCCAGAGGAGGAGGAGGAGGACGACGAC
ATCGTGGATGCCGGGGCGATTGACGATCTGGAG
Sequence Type mRNA
Unitrap ID UNI9742

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164732929..164733121 191
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039834 (Zfp335) NM_199027 zinc finger protein 335 Gene [Source:MGI (curated);Acc:Zfp335-001]

 
Come back to gene ENSMUSG00000039834


For any suggestions or comments, please send an email to unitrap@crg.es