Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG316
Clone ID XG316
Vector pGT1Lxf
Project baygenomics

Sequence tag XG316
Sequence
AACGGTTCATGGAATGTTTGATGATTGGCCGGGACCTTGTAAGATTACTTCAGAATGTTGNTAGGATACCAGAATTTGAA
CTACTGTGGAAAGATATCATCCATAACCCTCAGGCCTTGAGTCCTCAGTTTACAGGTATCCTACAGCTACTTCAGTCAAG
AACATCCCGAAAATTTCTAGCCTGTCGTCTAACCCCAGACATGGAAACGAAGCTCCTCTTCATGACATCCCGGGTGCGGT
TTGGCCAGCAAAAGCGGTACCAGGACTGGTTCCAGCGCCAGTACCTCTCAACCCCTGACAGTCAGTCTCTGCGCTGTGAC
CTCATTCGATACATCTGTGGGGTAGTCCACCCCTCTAACGAAGTGCTGAGTTCTGATATCTTGCCCCGGTGGGCCATCAT
TGGCTGGCTCCTGACAACATGCACGTCCAACGTTGCTGCCTCCAATGCCAAGCTGGCTTTGTTTTATGACTGGCTGTTCT
TCAGCCCAGAAAAGGATAGTATTATGAACAT
Sequence Type mRNA
Unitrap ID UNI9749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90208438..90214050 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es