Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG366
Clone ID XG366
Vector pGT1Lxf
Project baygenomics

Sequence tag XG366
Sequence
AAACAGGCAGCTGAAGGACCCTGTAAACTTTCACGGCCTGGATTCTGGGATCCTATTGGAAGATATAAATGGGATGCTTG
GAGTTCACTGGGTGATATGACTAAAGAAGAAGCCATGATTGCATATGTTGAAGAAATGAAAAAGATTATTGAAACCATGC
CCATGACTGAGAAAGTGGAAGAGTTGCTGCATGTTATAGGTCCATTTTACGAGATTGTAGAAGACAAAAAGAGCAGCAAG
AGTTCTGACTTGACCTCAGATCTTGGTAATGTTCTGACCTCTTCAAATGCCAAAGCTGTTAATGGTAAAGCAGAGAGCAG
TGATAGTGGGGCTGAGTCTGAAGAAGAAGAGGCCCAAGAAGAGTTAAAAGGAGCAGAACAGAGCGGCAGTGATGATAAGA
AAACGCTGAAGAAATCAGCAGATAAGAATTTGGAAATCATTGTTACCAATGGCTATAAAGGTAGCTTTGTTCAGGATATA
CAGAGTGACATTCATACTGATTCTTCCCGGAGCACCAGAAGCAGTGAAGATGAAAAGCCTGGAGATGAGAGCTCTCAGCA
GACAGGACACACCATTGTCTGTGCTCACCA
Sequence Type mRNA
Unitrap ID UNI9750

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22931060..22945306 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es