Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST12683
Clone ID OST12683
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST12683
Sequence
AGCCAAAGGCCTCAATGCAGTATCAAATTCAACAAATGAGACCTTCTATGAAGCTGACGATGGGACTCAAGAGAAAACAA
TGGATATAACACAAATCAATATTGCCTGTTAGTTAAAATCCCTGTTTTGAAAGTTTATCTGAGAGAGGGAGCATTAAGAA
TAAAGAATGAAAAAAAATACAA
Sequence Type mRNA
Unitrap ID UNI13825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 105635946..105636127 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042655 (A930021C24Rik) NM_029984 family with sequence similarity 159, member B Gene [Source:MGI Symbol;Acc:MGI:1925053]

 
Come back to gene ENSMUSG00000042655


For any suggestions or comments, please send an email to unitrap@crg.es