Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XG593
Clone ID XG593
Vector pGT1Lxf
Project baygenomics

Sequence tag XG593
Sequence
GTACCATCACGTGGAAGGTTTTCATGAGCTCCGGGAGGCCCGCAAGTATGCCAGTGGGCTGTTGAAGGTGGGACTCATCT
GGCACACCGTCAACAAGATTACTTTCTTTGAGCAGTGCTATTATGTCTTCGGGGACCTCAGTGGTGGCTGTGAGAGTTAC
CTAGTTAACCTCTCTATGAATGACAATGACGGTTCCAGTGGGGCTTCAGACCAGGATACCCTGGCACCTCTGCCTGTAGA
TACTCCATGGCCCGTGATGCCCACCTTCTCATACCAGTATCCAGCGCCACACCCCTACAGCCCCCAGCCTCCACCCTACC
ACGAGCTTTCATTCGTACACTTATGGTGGAGGCAGTGCCAGCAGCCAGCACAGTGAG
Sequence Type mRNA
Unitrap ID UNI9761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 69821805..69822496 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020888 (Dvl2) NM_007888 dishevelled 2, dsh homolog (Drosophila) Gene [Source:MGI (curated);Acc:Dvl2-001]

 
Come back to gene ENSMUSG00000020888


For any suggestions or comments, please send an email to unitrap@crg.es