Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST12120
Clone ID OST12120
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST12120
Sequence
GCCCGGCCTGCCTCTCACCCCCTGCAGATGGGGCCCTGCTCCTATGAGATCAAGCAGTTCCTGGACTGCTCCACCACTCA
GAGCGACCTAACCCTGTGTGAGGGCTTCAGCGAGGCCCTCAAACAGTGCAAATACAATCACGGTCTGAGCTCCCTGCCCT
GAAGAGGCTGTGGGCCTGCTCATCGCCTAACCCCTCACCGACAGCTTGATGGAAAGGAGAGGTTCCATGTGACTGGGAGT
AAGGAAGGATCGTTCTCACCCCGCAGACTANCAGGAGACATAATTATTCAATTAAAAAGTTTACTTTAGACCACAAAA
Sequence Type mRNA
Unitrap ID UNI13550

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75400058..75400492 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049422 (Chchd10) NM_175329 coiled-coil-helix-coiled-coil-helix domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2143558]

 
Come back to gene ENSMUSG00000049422


For any suggestions or comments, please send an email to unitrap@crg.es