Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST11872
Clone ID OST11872
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST11872
Sequence
TCTGCCCCAGAGGTTACATCAATTGAACTTTTAATTAAGTTCTGCTGATTCCTTGCTCCTGTATCTTCAGTGAAATGTGC
CTTGTGCTCCCACACGTCATCAACCTAAAAAGAAGTCCTTAGTGAGGATAAACTAGTGTTTCATAATTTTGTTTCCTTTT
TCTCTTTCTTCAGTTCCTTCTGTATTCAAGGGGTTAAGGAACCCGGGGCAATTATCTTGGAGACGTAATTTTTCTGGATA
TCAATCAATAAAAGCAAATATGATTTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI29029

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 98907209..98907477 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044860 (Gm1123) NM_001080776 gene model 1123, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685969]

 
Come back to gene ENSMUSG00000044860


For any suggestions or comments, please send an email to unitrap@crg.es