Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST11812
Clone ID OST11812
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST11812
Sequence
GGCTCTCACAGGATAAGGCTTTATGAGAGAGATGACTACCGGGGCCTTGTGTCTGANCTCATGGACGACTGTTCCTGCAT
CCACGATCGCTTNCGCCTCCATGAGATCTACTCCATGCACGTGCTGGAGGGCTGCTGGGTCCTCTATGAGATGCCCAACT
ACCGANGCCGNCAATACCTGCTCANGCCTGGAGACTACAGG
Sequence Type mRNA
Unitrap ID UNI29030

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 65147096..65147295 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044429 (Cryga) NM_007774 crystallin, gamma A Gene [Source:MGI (curated);Acc:Cryga-001]

 
Come back to gene ENSMUSG00000044429


For any suggestions or comments, please send an email to unitrap@crg.es