Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH230
Clone ID XH230
Vector pGT1Lxf
Project baygenomics

Sequence tag XH230
Sequence
GGGACACTCGTTAAGAGTCATCTCGTCGCAAATGCTGATGTGCAGTCTATTGCTGTTGCTGATCAAGAAGACAGTTTTGT
GGTGGGCACCGCCGAGGGCACGGTATTCCATTTCCAGCTGGTGTCCATGACTTCCAACAGCAGTGAGAAGCAGTGGGTGC
GGACGAAACCGTTCCAGCATCACACTCATGACGTGCGTGCTGTGGCCCACAGCCCAACAGCCCTGATCTCAGGAGGCACC
GACACCCACCTGGTTATTCGGCCTCTCATGGAGAGAGTGGAGGTAAAGAATTACGATGCTGCTCTCCGAAAGATCACGTT
CCCCCATCGGCGTCTCATTTCCTGTTCAAAAAGAAGGCAGCTTCTCCTTTTCCAGTTCGCGCATCACTTGGAACTGTGGA
GACTAGGATCCACATCTGCAA
Sequence Type mRNA
Unitrap ID UNI9776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109428282..109432198 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041438 (Cirh1a) NP_035704 cirrhosis, autosomal recessive 1A (human) Gene [Source:MGI Symbol;Acc:MGI:1096573]

 
Come back to gene ENSMUSG00000041438


For any suggestions or comments, please send an email to unitrap@crg.es