Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST11616
Clone ID OST11616
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST11616
Sequence
ACCTACCGGGGGAGTNAAAGAGATGNGGNACCTGANGAAAGCCATCTATCTGCCTGTTTCTTTCCCAGACTTAGCCACCC
ACACAAATCATGGGCTTTGTTCTCATCAAAGGACATGAAGTTGCTGCTTGCTGAAGATATTCTAGCTGCCCTGGAGTTTC
ATAATGGGAAGCTGTGACTTGGGTGTCAATAAAGAGAGTTTCAACACCTGC
Sequence Type mRNA
Unitrap ID UNI29036

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148023657..148023867 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025481 (1190003J15Rik) NM_029821 RIKEN cDNA 1190003J15 gene Gene [Source:MGI Symbol;Acc:MGI:1916142]

 
Come back to gene ENSMUSG00000025481


For any suggestions or comments, please send an email to unitrap@crg.es