Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH655
Clone ID XH655
Vector pGT1Lxf
Project baygenomics

Sequence tag XH655
Sequence
GGCTTTTGTGTTTCTCCAAACTCTGCGGCTTTCTCAAAGTTGGAACAGTGTGGCTTGCGCTCCGCGCTCGACATGGAGGA
CCCTCTGTCATTTACAGATGTGGCCATTGATTTCTCTGCAGATGAGTGTGAATGTCTGGACTCTGCTCAGTGGAATTTGT
ATAAGGAAGTGATGTTGGAGAATTACAGCAACCTTGTGTTCCTGGGTCTTGCTTTCTCTAAGCCATACCTGGTCACATTT
TTGGAGCAGAGTTCAGATCCGTGGAGCGTGAAGAGGAAAGCATCAGCGGCCATCCATCT
Sequence Type mRNA
Unitrap ID UNI9779

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67914757..67924130 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030446 (Zfp273) NP_938081 zinc finger protein 273 Gene [Source:MGI Symbol;Acc:MGI:3036278]

 
Come back to gene ENSMUSG00000030446


For any suggestions or comments, please send an email to unitrap@crg.es