Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST11304
Clone ID OST11304
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST11304
Sequence
GGTGCAAGTGCTAGATGCTCAAGAGGACACATAAGCAGACCCGAAACACGGCTTGACTTCCATGAGCGACAGGACCAGCC
CTACAGCGACCATGGATGTGCCGCGATCACTGCTTCTTCACGAATAAATTCACCCTCGAACTGTTAAATCAATAAAGCCT
ACTGCAGCCCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI12775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148032498..148032668 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038801 (Scgb1c1) NM_001099742 secretoglobin, family 1C, member 1 Gene [Source:MGI Symbol;Acc:MGI:2655401]

 
Come back to gene ENSMUSG00000038801


For any suggestions or comments, please send an email to unitrap@crg.es