Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH848
Clone ID XH848
Vector pGT1Lxf
Project baygenomics

Sequence tag XH848
Sequence
GGGTGGAAACAGGGCGATGAAGAAGAGGAATGGGCAGAGAAAGCTGTGGACGCTTTGGTGAAGAAACTGAAGAAGAAGAA
AGGGGCCATGGAAGAGCTGGAGAAGGCCCTGAGCTGCCCTGGACAGCCGAGTAACTGCGTCACCATTCCTCGCTCCCTGG
ATGGCAGGTTGCAGGTGTCCCACCGGAAGGGACTACCTCATGTCATTTATTGCCGTGTGTGGCGCTGGCCCGACCTCCAG
AGCCACCATGAACTGAAGCCTCTGGAATGCTGTGAGTTCCCATTTGGTTCCAAGCAGAAGGAGGTCTGCATCAACCCCTA
CCACTATAAGCGAGTGGAGAGCCCG
Sequence Type mRNA
Unitrap ID UNI461

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81895684..81896028 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031681 (Smad1) NM_008539 MAD homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Smad1-001]

 
Come back to gene ENSMUSG00000031681


For any suggestions or comments, please send an email to unitrap@crg.es