Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XH849
Clone ID XH849
Vector pGT1Lxf
Project baygenomics

Sequence tag XH849
Sequence
TTTTAAAAGGGTTTTTTTTTTTTTTTTAGCCGGCTTCACACGTGTGAACCTGGTGGGCAATTTTTTCGGCCAAAATGCCC
AAATTCAAGGTGACACGTGGGGCCAGCAATCGGGAGAAGCATGCACCTCTGGCCGAGCAGATCCTGGCTGGGAACGCAGT
GCGCGCGGGGACCCGAGAAAAACGGCGGGGGCGTGAGGTCGAAGAGGAGGAAGAGTATGTGGGACCCCGGCTAAGCAGAC
GGATTTTGCAGCAAGCCAGACAACAGCAGGAGGAGCTCGAAACTGACCATGGGGCTGGTGATCGGTCAGCACCACCGCGA
GAGCGCGCCACGCGGCTG
Sequence Type mRNA
Unitrap ID UNI3087

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47747857..48074462 316
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023988 (Bysl) NP_058555 bystin-like Gene [Source:MGI Symbol;Acc:MGI:1858419]

 
Come back to gene ENSMUSG00000023988


For any suggestions or comments, please send an email to unitrap@crg.es