Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST10927
Clone ID OST10927
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST10927
Sequence
GGTGCTGGAGTATGCACTGCAACTGTAGGCCGAGTATCCAACGTTAACCATAACCAGCGGGTCATCGGCAAGGCAGGAAG
GAACCGCTGGCTGGGCAAGAGGCCTAACAGTGGGCTGTGGCAACGCAAGGGAGGCTGGGCCGGCCGAAAGATTCGGCCAC
TACCACCCATGAAGAGTTATGTGAAGCTGCCCTCCGCTGCTGCCCAAAACTGATTGCCCTGGACTCTAATAAAATGTCTC
TTGTTTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI20551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46786832..46787081 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002767 (Mrpl2) NM_025302 mitochondrial ribosomal protein L2 Gene [Source:MGI (curated);Acc:Mrpl2-001]

 
Come back to gene ENSMUSG00000002767


For any suggestions or comments, please send an email to unitrap@crg.es