Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST10616
Clone ID OST10616
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST10616
Sequence
GGAGTACCTGGAGGATGTCATAAACTACCTCGTATCCACACTAGTGCTGCCCAAGATCAATGAGAGGCTGCGTAGAGGCT
TCCCTCTCCCTTTGCCTGCTGGGATCCGGTTCAGCCACTTCACGTTTTACCCCTACCAGAATTTCCTGTTGCTTGAAGCG
GATTTACACCTTATCTAAGATATCACCTTGGACCCTGGGCCAGGAAGCTCTGCAGCTGCTCCCATCACACTCACCGGCTG
TCCTGCTCCAGGAATCCTATTTAGTCTTTGGCCCTGACCTGTAGCCTCCTGCTTGCTTCCCCATGCTGAAGCTGAGGGGA
AAGCAGGAGATCTGTGTACCGGGGCCCTGTGCCTCTTTCAGAGCAGCCCCTCCAGCATCCGCATTTCCGCTGGAGGGGCG
ACATTACTTTGGGCTTTACAAGAACATCCATTTTTCCCCCTGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI13797

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 158107962..158110269 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052922 (Bpi) NM_177850 bactericidal permeablility increasing protein Gene [Source:MGI (curated);Acc:Bpi-003]

 
Come back to gene ENSMUSG00000052922


For any suggestions or comments, please send an email to unitrap@crg.es