Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC019
Clone ID RRC019
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC019
Sequence
GAGCAGGAGGAAGCAGGAGCAGGCCCAGCAGGGTACTGGTACCAGCCCCTCGATCAAGGCCCTGAGCAAGAAGAGGTGGA
ATTGGCACCAGTGGGTGAAGGAGAAGATGGAGCTGCTGACATCCAAGATCGGATCCAGGCCCTGGGGCTTCATCTGCCAG
ACCCTCCATTGGAGAGTGAGGATGAAGATGAGGAGGGAGCCGCCGCATTGAGCAGCCACAGCTCTATCCCCATGGACCCA
GGTCCCAGG
Sequence Type mRNA
Unitrap ID UNI9793

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46818709..46819062 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002768 (Mea1) NP_034917 male enhanced antigen 1 Gene [Source:MGI Symbol;Acc:MGI:96957]

 
Come back to gene ENSMUSG00000002768


For any suggestions or comments, please send an email to unitrap@crg.es