Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC051
Clone ID RRC051
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC051
Sequence
GGCAACCAACCTGAACGTTGGCACTTCCAGCAGCGCAGCCAGCTCTGTGAAAAAGCAGTATATTCAGTACCTGTTCGCCT
TTGAGTGCAAAACTGAGCGCGGGCAGGAGCCCCCACCTGAAGTCTTCAGCACCGGGGATTCGAAGAAGCAGCCAAAGCTC
CAGCCGCCATCTCCT
Sequence Type mRNA
Unitrap ID UNI9799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5321302..5321476 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es