Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST10042
Clone ID OST10042
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST10042
Sequence
AGCCACAACCTGGTGATGAAGCACCTCCCTGGGGCAGACCCCGAACTCGTGCTGTTAAGCCGAAATTACCAGGAACTAGA
GCGAATCCCACTCAGCCAAATGACCCGGGACGAGATCAATGCGCTGGTACAGGAGCTCGGCTTCTACCGCAAGTCGGCGC
CGGAAGCTCAGGTGCCCCCCGAGTACCTGTGGGCGCCCGCTAAGCCCCCCGAGGAAGCTTCAGAACACGACGACCTGTAG
CCCCGAGCCACAGTGGAGCTGGGACCCCCCCCTGCCAGCGCCCCGGAGACAGAATGAAGCGCTCAGTATCCCGGGAGCAT
CTCCCTTGCTGAGGGCCGACGCCAGTCTCCAAAGCAACGGAAATGGGG
Sequence Type mRNA
Unitrap ID UNI13996

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3416843..3417291 289
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075702 (Selm) NM_053267 selenoprotein M Gene [Source:MGI (curated);Acc:Selm-001]

 
Come back to gene ENSMUSG00000075702


For any suggestions or comments, please send an email to unitrap@crg.es