Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST10013
Clone ID OST10013
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST10013
Sequence
CACCACCACTGTACCGTATGCGAATNTTNGCACCCAACCATGTGGNAGGCCAAGTCCCGCTTCTGGTACTTTGTGTCACA
GCTGAAGAAGATGAAGAAGTCATCCGGGGAAATTGTGTACTGTGGACAGGTGTTTGANAAGTCACCCCTGCGTGTGAAGA
ACTTTGGCATCTGGCTGCGCTATGACTCCCGCAGTGGCACACACAACATGTATCGGGAGTACAGGGACCTGACCACTGCT
GGTGCAGTCACACAGTGCTACCGAGACATGGGTGCCCGACACCGTGCCCGTGCCCACTCCATCCAGATCATGAA
Sequence Type mRNA
Unitrap ID UNI11562

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73419554..73420159 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045128 (Rpl18a) NM_029751 ribosomal protein L18A Gene [Source:MGI Symbol;Acc:MGI:1924058]

 
Come back to gene ENSMUSG00000045128


For any suggestions or comments, please send an email to unitrap@crg.es