Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST9921
Clone ID OST9921
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST9921
Sequence
GGACAAAAGAATCCGAGTGTCTCAACCCCTGACAAGAGGACCAAGTGCCTTTATTCCAGAGAAGGAAGTATGGCCATTTG
TTTTTAATACATTATCTAGTCAAAAACTAAAAAA
Sequence Type mRNA
Unitrap ID UNI29063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14110642..14110751 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032009 (Sesn3) NM_030261 sestrin 3 Gene [Source:MGI (curated);Acc:Sesn3-001]

 
Come back to gene ENSMUSG00000032009


For any suggestions or comments, please send an email to unitrap@crg.es