Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRC071
Clone ID RRC071
Vector pGT1Lxf
Project baygenomics

Sequence tag RRC071
Sequence
ATCCACACACTTACAATCCCAAAATGAGTTTGCACATCAACACAGTGCAAGATGGGAGGCTTTGTAACAGCCGGGCACCC
TTGGCAGTTTCTGCATCTAAGAATGATGGGCCAGATCATCTGTCTGTAGAAGGAAATGAGACAAACACTATGGGCACAAA
TGACAAAGAGTCACCTCTGTTGAATGGGAGTGGAAGAGATGACTGTAAAGG
Sequence Type mRNA
Unitrap ID UNI9804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103238179..103238494 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032555 (Topbp1) NM_176979 topoisomerase (DNA) II binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920018]

 
Come back to gene ENSMUSG00000032555


For any suggestions or comments, please send an email to unitrap@crg.es