Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST9804
Clone ID OST9804
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST9804
Sequence
AGGGCCTGAAGAAGATATCTGACTACATGAAGAGCAGCCGCTTCCTCTCCAAGCCAATCTTTGCAAAGATGGCCTTTTGG
AACCCAAAGTAGGATTACAAAGCCCAGACCTGGGGGAATACTCATGAGTGCTCTGCTGGCCCTAGCTCTTACCACGTGCA
GCTTTCTTCTCCTTTCCATTCCCTATTCCTCCATTTCCTCTTCCCAGCCCTTCCCTCAGCCAAGCCTCTGGGTCCTTGGG
CTCTCCATTTCTTCATTAGTCTCCTCCTATCCCTTGTCTCTGCCCTGCATCCAGCCCTTCCCTCAGTGATGGTTGGAGGA
ATGTACTAGACCCGAGAATCCCCGGCCTGGCCTGAGAG
Sequence Type mRNA
Unitrap ID UNI29065

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 107784701..107785058 358
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040562 (Gstm2) NM_008183 glutathione S-transferase, mu 2 Gene [Source:MGI (curated);Acc:Gstm2-001]

 
Come back to gene ENSMUSG00000040562


For any suggestions or comments, please send an email to unitrap@crg.es