Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST059
Clone ID PST059
Vector pGT1TMtfa
Project baygenomics

Sequence tag PST059
Sequence
GCCCCACAGATCGGTCCCCACTCGCCCAAATTCACCTGCGCCTGCCCTGATGGCATGCTGCTGGCCAAGGACATGCGGAG
CTGCCTCACAG
Sequence Type mRNA
Unitrap ID UNI9808

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21548739..21548829 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032193 (Ldlr) NM_010700 low density lipoprotein receptor Gene [Source:MGI Symbol;Acc:MGI:96765]

 
Come back to gene ENSMUSG00000032193


For any suggestions or comments, please send an email to unitrap@crg.es