Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST9629
Clone ID OST9629
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST9629
Sequence
AGTTTTCCATAAAACCCATCAACACCAGTGGGATCTCCTTCACCTNTCACAGGTACCAGTCAGTGGCCCAGAGCTGGAGG
GCAAGCTCCTTCATCTCCAAGCTATGAAAACTCACTTCACTCCCTGCANANNNNANTGGAANACCGTTTACACNGGCTGG
ATNATGCTNTNCNTGTGCTNCGAANNCATGCNGTNGGACCTTCTACCANGCTGCCTACTAGCCACAGGGACATACACAGT
TTGCTGGGACCATCCCATAATGCATCAATTGGAAACCTCAATTCAAACTATGGAGGATCCAGCCTTGTTACAAATAGTCG
ATCAGCTTCGATGGTCGGAACACATCGGGAAGATTCAGTCAGTCTCAATGGCAATCATTCGGTCCTGNCTAGNACTGTTG
CTGCCTCAAACACAGAACTGAACCATAAACCCAGAAA
Sequence Type mRNA
Unitrap ID UNI25652

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71706656..71723847 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es